Date: 11.2.2017 / Article Rating: 4 / Votes: 546
Rts.rabotayes.compress.to #Custom essay writing services Trafalgar Castle School

Recent Posts

Home >> Uncategorized >> Custom essay writing services Trafalgar Castle School

Custom essay writing services Trafalgar Castle School

May/Fri/2018 | Uncategorized





Trafalgar Castle School School - boarding house …

Pay for Essay and Get the Best Paper You Need -
Girls Day & Boarding School | Trafalgar Castle

Buy Nursing Coursework Writing Help. Nursing coursework is an assignment that requires students to demonstrate their knowledge at essay Castle different stages of their program. It forms part of the requirements to attain the degree. If you asked anyone who has ever done it, they would tell you that it is not only a tiring task but also exhausting and derailing. For one to accomplish it, he/she needs distinguishable writing skills and knowledge. But at Justin-Siena High School times you can never be sure of what you are doing and might need the help of experts.

NursingWritingService.com has helped thousands of students to custom Trafalgar Castle open the doors of success in their careers. Whether you are a struggling or a top student, we are committed to help Tilton School provide you with high-quality coursework in all topics within your discipline. Through the years we have been offering nursing coursework writing services, we have assembled a team of experts who have high qualifications in diverse areas. Thus, when you place an order with us, you can be sure that a professional with relevant skills will work on writing services Castle School, it in the best way possible. Our writers have experience and thinking Justin-Siena often pay close attention to custom essay writing services Trafalgar School all the demands that clients put forward.

Need Professionally Written Coursework? Our specialized nursing coursework writers can help you with your paper today. 100% written from scratch. Over the a good Сolleges, years, NursingWritingServices.com has had a long history of customers who are happy and satisfied. 91% of services Castle School, them always return to place new orders and refer their friends and family. We keep our word on the guarantees that we give. When you come to us, you can be sure of: 100% plagiarism-free : We have a policy that stresses on originality and authenticity of the critical text High School, coursework that we write. Custom Essay Writing School? We work on critical thinking text High, all orders from scratch. Customized papers : We give our clients an opportunity to essay Castle School work with the critical text Justin-Siena High, writers working on their projects.

We always ensure that your coursework represents your views and opinions. Quality : While our writers always strive to give you the essay writing Castle, best, we offer free revisions in case a client is critical AUTO University, unhappy. Pocket-friendly prices : As a student, we know that sometimes you might be facing financial challenges. Hence, besides giving you a quality paper, we will not leave you with nothing for survival. If you are looking affordable coursework writing services that guarantee results, then you are at the right place.

Here are some of custom essay services Castle, what our returning clients say: Always delivering high-quality papers and on write essay Marangoni, time. NursingWritingServices.com is the best I have used. Thanks for always being reliable. Your writer was easy to work with, always patient and understanding. Custom Services Trafalgar? I would recommend your nursing writing services to everyone out there. Need Professionally Written Coursework? Our specialized nursing coursework writers can help you with your paper today. 100% written from scratch.

Unlike most companies that offer all manner of writing services, NursingWritingServices.com specialize in only one industry. Persuasive Cesar Ritz Сolleges Switzerland? Medical and Nursing field. All our writers, editors and top management is essay writing services Castle, comprised of individuals with strong medical background.It doesn't matter what you want. Whether it's a PhD thesis/dissertation or a Masters level or university essay, we have what it takes. All our services come with 100% money-back guarantee. NursingWritingServices.com was founded not by just other ordinally folks looking to make money out of medical and themes nursing writing business, but real medical and nursing trained individuals. The entire team of custom nursing writers have medical training backgrounds, a fact that makes us stand out from the custom services Trafalgar, others.

Our nursing writers can handle any assignment from college to university to PhD. Custom Written Papers Free from plagiarism 100% Privacy guarantee. Details of client never shared 100% refund guarantee for poorly written work Timely delivery of all Essays, research papers etc Qualified and experienced medical and nursing writers. Before you begin to work on write Istituto Marangoni London, academic research, you should present a research proposal. It is a concise summary of the essay, of the critical is SKODA University, research work you intend to carry out. A good proposal outlines the area of custom writing School, study under which your research will fall referring to your level of knowledge and a recent discussion on how to essay The University (Navitas), the topic. If a research proposal does not interest the supervisor or members of the committee, they will reject your research. You will begin another or resubmit the same after undertaking another round or preliminary research to custom writing School get new outcomes. If you are doubtful about help School your study idea, Nursingwritingservices.com will help you to explore information about it and put convincing facts on services Trafalgar Castle, your research proposal to allow approval of your proposed study. We assist students of all academic levels from college to PhD level.

Persuasive Nursing Research Proposal. A nursing research proposal should be convincing. When you seek help from Nursingwritingservices.com, we will deliver a research proposal that helps your examiners to get a clear idea on London, the research topic. Most students do not have ideas on how to write a proper research proposal. We help you to write the entire research proposal and even assist you with to come up with a topic if you had none. Need Professionally Written Research Proposal? Our specialized nursing research proposal writers can help you with your paper today.

100% written from scratch. Prolific Nursing Research Proposal Writers. Nursingwritingservices.com writers have incredible staff members who understand everything about custom essay services Trafalgar Castle writing research proposals. We look at the nursing research topic you intend to study and assign you a writer who trained in the area and has proven to how to write a successful essay (Navitas) have more a better understanding of the subject than others. We will match your order to custom essay services Castle a writer with holding a Masters or PhD degree.

A nursing research proposal should not have grammar errors that distract the readers and thinking is SKODA make the students appear ignorant about the Trafalgar School, research topic. Our writers are native English speakers who write error-free content. You can directly message your writer to follow their writing progress or exchange ideas about the topic. The expert team is also well versed in write a successful The University all formatting and linguistic styles. Essay Writing Services Trafalgar School? Inform us about your preferred writing style, and we will format and cite your proposal accordingly. Rejection is likely if a research proposal is closely similar to others. We are a responsible writing service and will not deliver what you can find elsewhere. Our writers begin by researching on the proposed study topic to get new ideas on how to School research on services Trafalgar Castle, it using a different approach from previous researchers. Justin-Siena High School? The selling point of your research proposal is that your project will generate new facts which will add to existing knowledge. Need Professionally Written Research Proposal?

Our specialized nursing research proposal writers can help you with your paper today. 100% written from scratch. Affordable Nursing Research Proposal Writing. Customwritingservices.com rates are affordable for essay Trafalgar Castle School everyone. The majority of our clients are students without paying jobs as the help a essay Tilton School, cost of writing Castle School, our writing service is pocket-friendly. We even offer special discounts. Fill the order form with your order details and instructions to receive an instant prices quote. There are no additional charges. Charging lower rates does not mean we compromise on quality.

All our writers have the necessary academic and mental capabilities to write quality research proposals. Writing Essay Cesar Ritz Сolleges Switzerland? We also have a group of editors to back up the essay writing Trafalgar School, work of our writers by reading every sentence in the proposal to determine if it is thinking is SKODA AUTO, grammatically correct. If you have an issue with the custom essay writing services School, quality of your paper, we will offer a free revision. Nursingwritingservices.com will come to your rescue anytime when your efforts to for essay writing Hult International Business write a nursing proposal stall and you contact us. We work 24/7, and you will get a qualified writer is your research proposal topic anytime. We assure you of total satisfaction from custom writing Trafalgar a research proposal that will lead to approval of your project. For more information about the services, Have a look at our Write My Nursing Research Proposal page. Writing Hult International? Nursing Writing Service is a life saver.

You sent me a nursing research proposal that my committee approved after rejecting the first one. Thank you. ” “ I am happy with the level of friendliness. My writer was ready for a detailed discussion of my research proposal and even accepted some changes I recommended. ” “I am grateful to Nursingwritingservices.com for providing me with the most appropriate writer for custom essay writing Castle my nursing research proposal topic. My supervisor was satisfied and allowed me to progress with the proposal. ” Need Professionally Written Research Proposal? Our specialized nursing research proposal writers can help you with your paper today. How To Write (Navitas)? 100% written from scratch.

Are you in the final stage of your course? You will only rest when you submit a dissertation that your committee accepts and awards an excellent grade after your defense. Essay Services Trafalgar? A dissertation is a final year assignment that requires you to perform independent research on a subject you choose and take it to your supervisor to determine if it is right. If approved, you research extensively on essay, the subject using an accurate methodology and discuss the findings in essay writing services Trafalgar your paper.

Custom Essay Writing Service -
Girls Day & Boarding School | Trafalgar Castle

Essay: Invesigating MH17 Forensic DNA analysis. On July 17th 2014 a Malaysian airplane crashed near Hrabove, Ukraine. There were 15 crew members and 283 passengers on board of this deadly crash. During this time the plane was flying over a warzone, the suspicion therefor is custom essay services, that the how to write a successful essay of Canberra (Navitas) plane might have been hit by a missile as part of custom essay writing services School, a terrorist attack. Researchers must investigate the cause of the crash of the MH17 flight. One of the goals of the investigation is to recover and identify the victims on board. Persuasive Switzerland. This report focuses on the identification of the victims through forensic DNA analysis. It describes the steps that needs to writing Trafalgar School, be taken before DNA profiling can begin and various DNA analysis techniques.

Lastly there will be a transcript of an interview with a forensic DNA expert. For the identification of humans in mass disasters, DNA analysis is a gold standard especially when a victim cannot be identified using their physical characteristics (e.g. A Good Cesar Сolleges. birthmarks, tattoos, medical implants, clothing and custom essay writing Trafalgar School, jewelry), forensic anthropology, fingerprints, odontology and radiology. Forensic DNA typing is used for identification if/when sufficient DNA data can be collected from any biological sample and body parts. DNA can sometimes be recovered even when victim`s remains are fragmented and DNA is degraded. DNA analysis is critical thinking is SKODA AUTO University, also often used for the re-association of severely fragmented remains with the victims, because this is the only technique that allows it. DNA analysis is a technique that requires more time, effort, and specialized, skilled personnel [1]. In order to make a positive identification, reference samples from possible victims are collected so the DNA samples can be compared to each other. Custom Castle. Reference samples can be collected from how to of Canberra, several different sources.

It can be collected from personal belongings that were frequently used by the victim (e.g. toothbrush, hairbrush, razor, unwashed undergarments). Banked samples can also be used. Think of banked sperm or archival biopsy tissue that is stored in custom services Castle a medical facility. Other biological samples that can be used is blood stain cards, blood stored for elective surgery, pathology samples, and extracted adult or baby teeth. Another source for a reference sample is how to write The University (Navitas), via biological relatives of the victim that are collected using buccal swaps [1]. The reference samples can be categorized by the DNA quality of the DNA that is available on the samples and they are good sources of DNA, fair source of DNA and poor sources of DNA (see table 1). [2]. Table 1: Categorization of reference samples in good, fair and poor sources of DNA[2] Good sources of custom services School, DNA Fair sources of DNA Poor sources of DNA. Tooth brushes Lipstick Jewelry. Razors Deodorant sticks Wrist watches. Hair brushes Pillow cases Outer clothing.

Bone marrow samples Used cups/glasses Towels. Blood cards from text, PKU screening Used underwear Shoes. National bio banks Fingernail clippinds Hair bands. Criminal databases Cigarette buds Baby hair. Serum samples Pipe Dentures. Sperm bank samples Mouth piece/guard Hair rollers. Dried umbilical cords Helmets/caps/hats Trimmers. Pathology speciman Earplugs. Inner clothing items (bra, socks, t-shirts)

Pen with teeth marks. There is several preferred combination of family reference samples. The preferred combinations are; both parents; one parent, spouse, children; children and spouse; one parent and sibling; two or more siblings; known identical twin. From all the combinations possible for custom essay services Trafalgar School, the kinship analysis, the write essay The University (Navitas) probability for their effectiveness has been calculated. The three lowest combinations are one full sibling (92.1%), sibling and aunt (94.4%) and writing Trafalgar Castle, sibling and writing a essay School, two aunts/uncles from Castle School, same side of the family (97.8%). The three highest combinations are three grandparents (96.7%), four grandparents (99,99%) and is SKODA AUTO University, lastly three grandparents and siblings (99,994%). The full list is shown in table 2. [3]

Table 2: Probability of identity using various combinations of family references [2] Family references Probability of identity (%) One full sibling 92.1. Sibling and custom services Trafalgar, aunt (or uncle) 94.4. Sibling and two aunts (or uncles) from same side of the family 97.8. Sibling, aunt, uncle from different sides of the write essay Istituto Marangoni family 99.8. Sibling and half sibling 98. Sibling and two half siblings (same mother) 99.4. Two siblings 99.91. Sibling and parent 99.996. Father and one maternal half sibling 99.95.

Father and custom essay services School, two maternal half siblings 99.996. Father and maternal aunt 99.993. Three grandparent 96.7. Four grandparents 99.99. Three grandparents and sibling 99.994. Previously identified fragmented remains that were already identified using DNA can also be used to make identification [1]. There are several limitation as to the retrieval of remain and write Istituto, reference samples. One of these limitations can be environmentally harsh condition at essay services incident sites. This can severely limit the quantity of help School, usable DNA from human remains. Also passengers that travel via airplanes, take their personal belongings with them in the luggage. This means that these personal items may also be destroyed during the plane cash and cannot be used to make a reference sample.

In some cases using DNA from a close relative can also be difficult. Reasons being that sometimes families travel together and custom Castle School, are also victims in the crash. Sometimes certain relatives also choose or are unable to give a DNA sample. It is also important to establish that personal items collected was only used by the victim in order to writing a good persuasive essay Cesar Ritz Сolleges Switzerland, avoid getting a mixed profile or giving a wrong identification. Trafalgar School. [1]. Parameters of DNA identification. The importance of DNA in the identification process is dependent on the degree in which the human remain is fragmented or degraded. Sometimes multiple methods are used in order to identify a victim. This doesn’t always include DNA. In an airplane crash only about 25% of victims are identified by only using DNA analysis as a method of thinking text High, identification. The parameters are set by policy makers and it is the job of the laboratory director to determine the custom essay writing services Castle School nature and extent of the laboratory`s response. [1].

Defining goal of help writing Tilton, identification process. Depending on the scope of the identification process, a decision can be made on if every human fragment is essay writing services Trafalgar Castle, going to be identified. In an airplane crash for instance, there can be 50 victims and each remains can be fragmented in multiple pieces. If the goal or policy is to identify each victim, one would be done sooner with the help identification process. This because DNA analysis would be stopped when all 50 victims have been identified. Some human fragments will therefore never be analyzed and returned to the families.

Whenever the custom services School goal or policy is the attempted identification of all fragments, obviously this will result in text Justin-Siena a greater work for essay writing, the laboratory. The scope of the investigation is determined by how large and devastating a mass disaster incident is to a community, a country or to the world [1]. Minimum fragment size. Depending on the goal or policy of the identification process a minimum fragment size for DNA testing needs to be established. If all fragment pieces would be collected and then tested, many of them would not give out a positive result. Essay Ritz Сolleges. This would also cause the identification process to take longer and would also make it very costly. Even though the families are able to receive more human remains of their loved one, but they very well are going to be unprepared on services Castle School the condition of the fragment and help a essay Tilton School, the time it might take to be able to identify them. Knowing all that, decisions will be made regarding the Castle minimum fragment size, the statistical threshold that must be met.

The minimum fragment, which is usually one to ten cm long should be based on three criteria. Write A Successful Essay The University (Navitas). The first criteria is maximizing the probability that all victims are identified. The second criteria is the recognizing the emotional needs of the victims’ families and friends and the third criteria is he providing forensically relevant information. Custom Writing Castle. The defining of the for essay writing International Business School fragment size is Trafalgar Castle School, important, because this will affect the identification effort. It will determine how fragment sizes needs to how to write a successful The University of Canberra, be collected at the crash site, how they will be processed and the likelihood of getting a useable DNA profile [1]. A preliminary decision concerning the DNA technology that should be used is made by the laboratory. If the recovery effort is long, the custom essay Trafalgar School DNA of the for essay School fragments will start to degrade and can affect your choice of DNA method for analysis. Custom Services Castle. The decision to use another DNA method that are not the standard choices can be implemented, depending of the environmental conditions at for essay Hult International School the crash site and the resulting DNA degradation.

It can also depend on the scope and the duration of the DNA effort that has been set [1]. STR (Short Tandem Repeat) analysis has been proven to be a powerful method for DNA identification in mass fatality incidents. There are three known airplane crashes where the victims were identified only by using STR analysis. Remains from after WTC attacks, demonstrated that STR`s work on custom Castle degraded tissue and bone fragments if DNA extraction is optimized. Although additional methods may be needed if a sample is severely compromised to generate a statistical threshold. Other methods that can be used are mtDNA (Mitochondrial DNA) and SNP (Single nucleotide Polymorphism) [1]. Length of recovery effort. The length of the recovery effort it dependent on the location site and the mass fatality of the crash and determines the critical thinking University DNA identification of the victims. Essay Trafalgar Castle School. When remains are collected from an airplane crash on land, it will usually take up to two weeks for it all to be collected. In a mass fatality identification process will begin as the critical text High School samples are collected and delivered to the laboratory.

It is more effective and essay writing Trafalgar Castle School, efficient to wait for all the samples to essay of Canberra (Navitas), be collected, but with the pressure from the public and families for a rapid confirmation this is not possible. The collecting of the reference samples also plays a part on the length of the identification process. After a mass fatality personal belongings and biological samples are sent in batches. Custom Services Trafalgar Castle. So the number of batches and the frequency of which they are sent to the laboratory is dependent on efficiency and duration of the themes writing Business School reference collection process [1]. After considering all of the above, the laboratory`s must determine its analytical processes. Several key variables has to be assessed in order to determine this. These variables are the number of victims, number of writing, recoverable fragments, percentage of a good persuasive essay Cesar Ritz Switzerland, samples to essay services School, be reworked, numbers of personal items per victim, percentage of personal items to text School, be reworked, personal items quality control samples and number of kinship analysis.

In order to predict the labor and essay writing School, material resources required for write essay Istituto Marangoni London, DNA analysis, a DNA analysis workload worksheet can be used (see appendix 1) [1]. In a mass fatality event DNA identification response demands forensic casework skills and high throughput genotyping or databasing from the public and/or private sector. In case of STR genotyping, there is a difference in analysis for medical or research purposes. This means that laboratories that can perform high quality clinical or research purposes, can be considered only after careful consideration. DNA collection from human remains and personal items all require chain of custody protocols that clinical or research laboratories are not typically using. DNA extraction needs to be performed by using forensic casework extraction protocols. Kinship samples on the other hand are more assessable to standardized high-throughput processes used by forensic databasing laboratories and non-forensic genotyping laboratories. In most cases forensic databasing laboratories have the custom essay School experience with outsourcing work to private laboratories then forensic casework laboratories. Writing Essay Ritz Сolleges Switzerland. In case that work is essay writing services Castle, outsourced to other laboratories, it is important to essay London, ensure that all laboratories involved use the same molecular ladders as size standards for allelic interpretation.

They also all have to essay, use the same DNA analysis protocols that permits standardized evaluation of victims profiles. Writing A Essay. The way of work in laboratories between forensic and non-forensic laboratories can vary. It is the duty of the laboratory director to fully define certain terms like ‘acceptable positive and essay writing services Castle, negative controls’ and ‘standard reaction volume’ [1]. Next to DNA analysis the Hult Business laboratory might also be responsible for sample accessioning and tracking, making identifications and resolving metadata problems, quality control, interacting with families and media and long-terms sample storage. Failure to address these activities will results in source shortfalls. The laboratory director must also consider the impact of the mass fatality incident response on the laboratory`s primary mission. Backlog and turnaround times will most likely increase for the regular casework. That’s why plans to manage both a mass fatality and regular casework should always be developed in case of an emergency. The duration of recovery effort also has an effect on the capacity of the laboratory. A rapid recovery effort that usually takes from one to three months creates a spike in the casework, but because that is a short casework they are able to recover quickly. A longer recovery effort is possible without affecting regular casework, however the identification process will still drain the personal and resources.

Good planning is writing services, critical in order to migrate the disruption [1]. Sample tracking is an important factor in ensuring quality and accuracy throughout the process of DNA identification. So this means that chain of custody and origin are very important when handling samples. They are critical aspect to the identification management process and to the collection of reference samples for comparison. If samples are not properly coded and help writing Tilton, tracked this can have a consequence on the identification process.

Even ‘simple’ problems like the inadvertent reference-sample switching by families of the victims, misspellings in names or unlinked names nicknames to last names. Also inconsistent case numbering during sample collection on the crash site. All those mentioned above can greatly influence the efficiency and accuracy of identification process [1]. Public forensic institutes usually have a chain of custody in place already and will use this system with only slight changes if the need arises in custom essay School a mass fatality incident. When documentation is started on a reference sample brought in by a family member of a victim, it might not be unusual to get a mixed DNA profile as a result. So this is how to a successful The University, also an important note to make when getting a result on your samples. But before these decision are made is how they are going to threat the mass fatality incident. Trafalgar. They can be dealt with as a humanitarian effort, civil incident or criminal requirements. By establishing what type of treatment you are dealing with, you can decide what your chain-of custody requirements will be.

The implications of themes, treat incidents are shown in figure 1 [1]. Figure 1: An overview of the possible treat incident and their implications [1] Laboratories will already have an information management system in place. In a mass fatality they can keep using the system they already have in place in order to maintain a high efficiency for their sample tracking. Essay Writing Services Castle School. If chosen to critical text Justin-Siena High School, modify the system the director of the custom essay Trafalgar laboratory should consider tracking the mass fatality samples separate from their regular casework samples.

The coding of the samples should begin with another number sequence that is regularly used in text Justin-Siena School the designated laboratory. Custom Castle. The laboratory should also consider having a team whose sole purpose is to enter the collected data and check if all samples are correctly coded. Another task that the laboratory director has to establish is the sample naming that differentiates the personal items, kinship samples and how to a successful essay of Canberra, the disaster samples from each other. The laboratory will also need to document the number and the type of analysis performed on every sample that is tested. Custom Essay School. In table 1 there is an overview of the documentation that are generally noted on test samples [1]. Table 3: Coding that should be present on test samples [1] Victim samples Personal effects samples Kinship samples. Identity of laboratory that performed extraction and analysis* Victim identification number Victim identification number. Extraction attempt number Identity of laboratory that performed extraction and analysis* Relationship to victim. Type of analysis Extraction attempt number.

Plate number, tube number, well number, etc. Type of analysis. Plate number, tube number, well number, etc. *These are usually noted in a multi-laboratory response. The recovery and preservation of samples are very important steps for the identification of human remains, especially when they are highly fragmented. It is very important for samples to be collected as soon as possible. But depending on text Justin-Siena High School the crash site and the environment it sometimes take much longer.

Proper preservation is writing services Trafalgar Castle School, also important so that DNA can stay intact and in that way get a successful DNA profile [2]. Depending on the state of preservation that is available, different tissue types should be collected. When sample collection cannot be done immediately and takes several weeks after the incident and/or the crash site was in challenging environmental conditions, bone and teeth proved to be the most reliable sources for a successful DNA profile. In case of a bone sample, the cortical bone from writing a good essay Cesar Switzerland, weight bearing long bones of the legs should be the first choice for DNA extraction. Essay Writing School. With degraded remains it is Tilton School, however still recommended to also take a swab in addition with the bone sample. The type of sample that should be collected is dependent on the state or condition that the body is in. Figure 1 shows an overview of the post-mortem sample condition that is dependent on the condition of the Castle body [2]. Because it is a possibility that commingling of DNA can be happen, this can often lead to help Tilton, false DNA-based associations. This is essay services School, especially true for Tilton School, fragmented remains.

Blood from different fragmented remains that contaminate each other or animal activity, can often be the source of the comingling of DNA. This means that analyst always has to be on the lookout for cross contamination. Essay Writing Services Trafalgar School. When collecting samples in the field, workers should never assume that fragments go together or belong to thinking Justin-Siena School, the same victim based on their appearance. It is also advisable to custom essay writing Trafalgar, have an thinking is SKODA AUTO anthropologist or a trained forensic pathologist on custom essay writing Trafalgar Castle School field in critical order to custom writing Trafalgar School, make sure that animal remains are not collected along with human tissue. The amount of samples that is going to be collected during a mass fatality may very well be too much for thinking text, one laboratory to store. So in that case the laboratory that is going to be handling the analysis can ask other trustworthy laboratories to store a collection of their samples. To keep decomposition to a minimum, samples need to be stored in custom services Trafalgar Castle low temperatures of around -20oC. Dried stains also needs to critical, be stored in freezing temperatures, but if this is not possible room temperature in custom essay writing services Trafalgar Castle a low humidity temperature will also work. Skeletal remains that are going to critical thinking AUTO University, be stored also needs to be at room temperature.

Reference samples are precious and can be limited, so the proper storage for reference samples are also very important [2]. In order to custom writing Castle School, be able to essay London, perform a successful DNA analysis, the laboratory needs to have sufficient additional processing are. Because of the mass fatality the laboratory is going to be dealing with a lot of samples and might need to consider using a robotics system. This can minimize human error and contamination. Trafalgar Castle. In case of mass disasters contamination and write Marangoni, mixtures of samples is unavoidable. For this reason the DNA typing used to make be able to make profiles needs to be well established. Custom Essay Writing Castle School. The most used DNA typing methods which are STR and mtDNA are the most used for thinking University, identification purposes. But depending on the state of the samples, other typing methods can also be used [3]. Before DNA analysis can be performed, the DNA needs to be extracted from the reference and victims samples first. It is customary to perform DNA extraction on the unknown evidentiary samples before the known or reference samples.

With samples from a mass disaster it may not be possible to writing services Trafalgar Castle, still extract samples in that order. But DNA extraction from victim’s samples and reference samples should be separated by time and/or space. Help. DNA typing relies on custom writing Trafalgar the success of DNA extraction that yields enough quantity, quality and themes for essay writing School, purity. Because of essay writing services School, this naturally the critical is SKODA AUTO most desired extraction methods are the ones that minimizes DNA loss and the ones that overcome, removes or dilutes enzymatic inhibitors [3]. The DNA IQ’ System (Promega Corp, Madison, WI) Current techniques that include organic solvents and custom writing services Trafalgar Castle School, ion exchange resins are time consuming, use more than one centrifugation step, uses toxic organic solutions and/or do not remove PCR (Polymerase Chain Reaction) inhibitors well enough. A system that was used for the extraction of themes for essay writing Hult International School, WTC samples proved to be the best. The DNA IQ’ System (Promega Corp, Madison, WI) uses a magnetic resin that the DNA can bind to. Essay School. It also has a denaturing agent that disrupts many types of cells/tissue.

The DNA will then be purified by eluding it from the resin. DNA typing can then be performed without needing further preparation. See figure 3 for a schematic overview of the extraction. The system minimizes the how to write The University of Canberra loss of DNA and the efficiency of DNA extraction also increases [3]. As is mentioned above organic extraction is also an extraction method that is widely used in the forensic community for DNA typing. As the name indicates, organic extraction uses organic chemicals in order to extract DNA. This occurs in four steps. In the first step EDTA is added to the lysis buffer. EDTA is added to prevent the degrading of DNA. Tris which is essay writing Castle, also present in help a essay Tilton the buffer makes sure the outer cell membrane become permeable. In the second step the proteins are denaturized and essay writing, hydrolyzed.

The lysing of the cell is carried out by using detergents Proteinase K and dithiothreitol (DTT) which are present in the lysis buffer. They insure that proteins and how to write (Navitas), cell debris are separated into organic phase and essay writing, the DNA remaining in the aqueous phase. They make sure that the cell membrane lyse, separate histones and denature histone proteins and critical AUTO University, destroy protein structures [5]. Custom Essay Services. In the essay The University of Canberra third step the proteins and cell debris are removed by adding phenol chloroform isoamyl alcohol to the mixture. The phenol present wont mix with water and the proteins and debris will have an affinity with the organic phase. After centrifuging the mixture will have visible layers.

DNA will be present in the upper layer called the aqueous phase. After transferring this phase to a new tube, in custom writing the fourth step DNA can be purified by using alcohol precipitation [5]. Figure 4 shows a schematic overview of the organic DNA extraction. Another popular extraction method in International Business School the forensic community is essay writing services School, Chelex. Chelex comes in different purities with a purity of 100 being preferred in help a essay School a forensic capacity. The resin has a styrene divinylbenzene copolymers with paired polyvalent metal ions. Because of this polyvent metal ions can bind to the resin. In an custom writing services Trafalgar School aqueous alkaline condition the themes writing Business School chelex has increased affinity for heavy metal.

When the mixture is also boiled, this disrupts cell membranes, cell proteins and it denaturizes DNA. After centrifuging the resin and cellular debris is separated. The advantages of Chelex is services Trafalgar Castle, that its time saving, doesn’t cost much and it minimizes contamination potential. Contamination potential is minimized, because unlike organic extraction it has less steps. Other advantages are that it uses no hazardous chemicals and removes some PCR inhibitors. Some disadvantages includes potential degradation for long term storage, the resin remain which can inhibit PCR and won`t work with all samples [5].

A schematic overview of the chelex extraction is (Navitas), shown in figure 5. Polymerase Chain Reaction (PCR) After extraction is completed the DNA goes through PCR. PCR is an custom essay services Trafalgar enzymatic process in which a specific DNA fragment is being replicated over and over again. The process works by the heating and cooling the DNA extracted samples in a precise thermal cycle pattern for ?? 30 cycles [6]. The PCR has three steps that forms one cycle [1]. In each cycle it starts with denaturing the DNA template by a essay Tilton School heat. In the second step the School temperature is cooled so that primers can anneal (bind) to the DNA. In the last step the themes for essay Hult International Business School temperature is raised again at custom essay writing Trafalgar Castle the optimal temperature for DNA polymerase so it can activate. Text High. The DNA polymerase extends the template strands (see figure 6) [6].

When the cycles are repeated multiple times, you will get an exponential accumulation of your desired DNA fragment when present. Even with a small amount of isolated DNA, the PCR can generate a large amount of DNA [1]. The primer, which is mentioned above, is the most important PCR component. The primer is a short DNA sequence that positions itself before the custom essay writing services Castle DNA fragment that needs to be copied. This means that the primer serves to identify the DNA fragment that needs to be copied. It is added in high concentration in relative to the DNA template in order to drive the PCR reaction. Other components that are added is naturally your template DNA that is going to be copied. Also added to the mix is a four nucleotide building blocks called dNTP`s and DNA polymerase that helps put the building blocks in text High the correct order on the template DNA.

The DNA polymerase used is Taq polymerase, which comes from a bacterium called Thermus aquaticus that inhibits hot springs. When setting up multiple samples that use the same primers, a master mix is made. From the master mix an equal amount of volume is pipetted in the PCR tube. By making this master mix you are insured homogeneity between samples and the pipetting of small volumes can be avoided [6]. In this version of the PCR more than one DNA fragment will be copied simultaneously. This is achieved by adding more than one primer to the mixture. Essay Writing Services School. In order for it to work properly, the help a essay Tilton School primer pairs added should have similar annealing temperatures. With the adding of extra primer pairs the complexity of primer interactions increases. Excessive regions of complementarity has to be avoided in order to prevent primer-dimer formation. Primer-dimers are when added primers bind to custom essay services Trafalgar School, each other instead of the template DNA. Critical Thinking Is SKODA University. The possibility of primer-dimer formation increases with every new primer pair that are added [6].

After DNA extraction, DNA quantification is essential for polymerase chain reaction (PCR) based analysis. This is custom essay writing Trafalgar Castle School, important because a low concentration is preferable when working with multi-plex PCR. Generally an amount of 0,5 to 2,0 of DNA is optimal when using STR kits. AUTO University. When a higher amount of DNA is used, this makes the interpretation of results harder and more time consuming. With a low amount of essay writing services Trafalgar Castle, DNA, this can result in loss of alleles. Writing A Essay. This makes it harder to properly compare profiles with each other [7]. Real-time quantitative PCR (qPCR) Like it was indicated above, quantification test is custom essay writing School, performed to determine amount of DNA that can amplified. A test that can indicate the quality and quantity of extracted DNA or PCR products, is beneficial for determining steps that need to be taking for the analysis of the DNA.

The most common approach to writing Tilton School, perform a qPCR is to use a flourogenic 5? nuclease assay, better known as TaqMan or with the use of an intercalating dye, like the SYBR green, that is specific for double stranded DNA molecules. The TaqMan monitors changes of a fluorescence while the SYBR green detects formation of PCR product [7]. Probes for the TaqMan has two fluorescent dyes that emit at custom essay writing services Trafalgar School different wavelengths. Essay Istituto London. The probe hybridizes specifically in custom writing services Castle School DNA target region between two PCR primers. Help Writing A Essay. The probe has a slightly higher annealing temperature the primers. This way hybridization of the probes can begin when extension of primers begin.

At the 5? end of the probe, a reporter (R) dye is attached, while at the 3? end a quencher (Q) dye is synthesized See figure 7. While the probes are still attached together, fluorescence won’t occur, because of the suppression due to energy transfer of the two. When polymerization starts during the PCR run, any TaqMan probe attached to target sequence will be displaced. Because Taq polymerase has a 5? exonucleae activity. This means that it will chew at the TaqMan probe attached. When the dyes are released from the probe, they will begin to Trafalgar, fluorescence. This means that, the more fluorescence that is signaled, the critical Justin-Siena more target sequence is present as complementary to the probe [7]. Real-time PCR analysis. The PCR process is essay writing services Trafalgar, defined in three phases. The exponential phase, linear amplification and plateau region.

These regions can be made visible in a plot of fluorescence versus the PCR cycle they are on (see figure 8). There is a high degree of precision of the making of new PCR products during exponential amplification. At 100% efficiency, there should be a doubling of PCR products with every PCR cycle. In a plot of cycle numbers versus log scale DNA concentration, will have a result of a linear relationship during the exponential phase of the polymerase chain reaction (see figure 8). The next phase is the linear phase. In this phase concentration of help writing, components falls and amplification efficiency slows down. This happens in an arithmetic increase. The final phase is the plateau region. Custom Essay Services School. This is where the production of the PCR products slowly stops. Multiple components that are being used for the amplification have reached the end.

The signal that is essay, being emitted slows down, causing the plateau to level out. The exponential phase of the real-time PCR analysis is the optimal place for measuring. This is the phase where the PCR product and the input DNA amount are most likely to essay Trafalgar, be consistent. The instruments use for writing Cesar Сolleges, real-time PCR uses a cycle threshold (CT) its calculations. This value stands for the terms of essay writing Trafalgar School, cycles when the level of fluorescence passes a threshold that is set by the software of the critical thinking text Justin-Siena real-time PCR instrument. The less cycles that is used to get to this threshold, the higher the input DNA molecules that was present in PCR reaction. This is why there is writing Castle School, a plot of log DNA and for essay writing Hult School, CT for every sample in a linear relationship with a negative slope. A rise in fluorescence can be traced to initial DNA template amount, when it is custom services Trafalgar Castle School, compared to samples that has known concentration. In figure 8, there are five samples (a, b, c, d, e) that were used in order to develop a standard curve. If the samples used have a good consistency and writing a essay Tilton, precision, a sample that has an unknown concentration can be calculated from the standard curve [7]. Short Tandem Repeat (STR) analysis.

STR analysis is the first method of analysis that is used [1]. 99,9% of the DNA in humans are the same. In the 0,1% region of DNA short tandem repeats are present as the region that exhibits a large variation between individual [7]. STR`s are short DNA sequence that keep repeating. For example in the DNA sequence ATTCGCATCATCATCATCATCATCATCGCCA, the sequence ATC is repeated 7 times. Short tandem repeats are present at the same position on chromosomes in writing Trafalgar Castle School the human genome, but the write essay Istituto repeat unit varies per individual. With the writing Trafalgar Castle help of PCR reaction a STR analysis can be performed.

Primers that can be labeled binds to the DNA at a specific STR loci and multiplied. Because of the label that is attached at the primer, the amplified products can be detected at the end of the PCR reaction. By analyzing more than multiple STR`s at once, a DNA profile that is unique enough to identify an individual can be made [7]. Sometimes a DNA sample is critical Justin-Siena, too degraded to get a DNA profile using the standard STR markers. In order to still be able to use this degraded DNA to get a profile, primers were repositioned. By repositioning the primers closer to the repeat region that needs to be amplified, the custom essay services Castle amplified product that is resulted is writing, much smaller.

As a result it makes genetic characterization of the sample for more STR`s, other that is used traditionally. This makes STR miniplex invaluable for custom essay, degraded samples [1]. Single Nucleotide Polymorphism (SNP) analysis. By using the SNP`s genetic markers, the PCR amplified product can be much smaller than is possible in a STR miniplex [1]. SNP is a single nucleotide mutation that occurs in the DNA sequence and is also the most common polymorphism in the human genome. These mutations can be a result from DNA replication or chemical damage. Justin-Siena School. A polymorphism is a variation/mutation in the DNA sequence that has a frequency of essay Trafalgar Castle School, more than 1% in the population. SNP occurs once every 1000 base pairs and tends to remain stable in themes writing Hult International School the population [8]. For example in a known DNA sequence of CCTAA, a mutation of the second C to a T occurs (see figure 9). The amplified PCR product that can result from using SNP markers can be reduced by custom essay services Trafalgar School up to 60-80 bp.

This makes severely degraded DNA samples that could not be typed using STR`s still typable. Using a method that was validated during the WTC identification effort, typing on samples that were much compromised was still able to be identified. The method uses a florescent detection system. By labeling the possible alleles with a fluorescent dye, the signal of the dyes could be compared [1]. Mitochondrial DNA analysis. Mitochondria is an organelle that resides outside the a essay Tilton School cell nucleus.

They contain their own chromosomal DNA. mtDNA are smaller, circular in custom writing Trafalgar Castle shape and are inherited maternally. They consist of approximately 16,569 base and have a high copy number in a cell. Thinking. Because mtDNA is passed down maternally, it is writing School, a good method to perform when reference samples are taking from maternal relatives. Using mtDNA can be an advantage when dealing with very small or degraded extracted DNA. Because of the high copies number of mtDNA that is available, an identification can still be possible using mtDNA markers, instead of STR markers that are found in nuclear DNA [1]. There are several differences in the characteristic of the mtDNA and the nuclear DNA. The first being the size of the themes writing Hult Business genome. Nuclear DNA has about 3,2 billion bp and is 99.75% of total DNA. Services Trafalgar. While mtDNA has 16,569bp and 0,25% content DNA per cell. Help Writing A Essay Tilton School. While mutation rata for nuclear DNA is low, mtDNA has a 5-10 times higher mutation rate. The sequence of the mitochondrial DNA is custom essay writing services, a functional one and also highly conserved, it’s because of this that there isn’t a very big variation between individuals.

But there is non-coding D-loop (1000bp long), also known as control loop, that has two hypervariable regions called HV1 and HV2 (see figure 8). The variations observed in this part of the DNA tend to themes writing Hult International School, be Single Nucleotide Polymorphisms (SNPs). The length of the mtDNA doesn’t change with the presence of the SNPs and that’s why this are the regions that are used for forensic analysis. Due to the lack of DNA reparation, mtDNA has a large mutation. This causes the variations between individuals. Custom Essay Writing Services Castle School. The variation is not a lot, with HV1 and HV2 having only critical is SKODA AUTO University, a 1-3% difference between individuals who are not related [10]. When analysis is performed, mitochondrial DNA is extracted and then with the help of Polymerase Chain Reaction (PCR), the essay writing services Trafalgar School HV1 and HV2 regions are amplified. Next step is to determine the sequence of the amplified product by using DNA sequencing.

After this samples can be compared to each other to themes for essay International School, get a possible identification [10]. The Y-chromosome is small and found in only male individuals. This chromosome is altered through infrequent happening of a mutation. The combination of alleles between father and son is theoretically the same, if mutation does not occur [9]. The advantages of custom writing Trafalgar Castle, Y-chromosome analysis are that in a mixture profile with female DNA for critical thinking Justin-Siena High, example in a sexual assault case, male specific amplification can take place to separate the two. Custom Essay Services Castle. Mixtures in fingernail scraping and saliva on skin can also be analyzed. Another advantage is critical thinking AUTO University, that it facilitates tracing family lineages in the paternal transmission. Limitations that arises are that it’s hard to distinguish between male family members when Y-STR typing is performed. Castle School. Duplications and deletions that are present in the DNA sequence, can make analysis more complicated. The Y-chromosome analysis is performed with the analysis of the STRs or SNPs. Write Essay Istituto. Y-STRs changes more rapidly and thus has more variables.

This makes it useful for forensic applications [10]. Last step in analysis of writing, DNA is the separation and detection of the amplified DNA. In order to how to write a successful The University of Canberra, separate and detect them a capillary electrophoresis is used. A basic capillary electrophoresis apparatus is consists of a narrow glass capillary, two buffer vials, two electrodes connected to high voltage power supply, laser excitation source, fluorescent detector, autosampler for samples and a computer that controls the sample injection and detection. The capillaries are made out of glass, have an internal diameter of 50 ??m and is 50 cm long. The capillary which is a glass tube is filled with a polymer that serves as a gel in which molecules can migrate. Essay Writing Services Trafalgar Castle School. Samples are injected in the capillary when high voltage is applied, which helps to separate the DNA fragments. Fluorescent dye labels that are present in the DNA mixture are analyzed when they pass by a detector that uses a laser beam. The results are then analyzed and writing a good Ritz Сolleges, stored on a computer [10]. A schematic of the capillary electrophoresis is shown in figure 9. DNA separation occurs when DNA fragments separate through the capillary when voltage is applied.

Smaller fragments go through the custom writing services Trafalgar capillary faster than the bigger fragments. The time is converted to base pair size with the help of internal size standards. Several components can affect the DNA separation. The polymer used, the capillary, the buffer and the voltage used [10]. The two primary polymer are POP-4 and POP-6. The POP stands for performance optimized polymer and is made out of a linear, uncross-linked dimethyl polyacrylamide. The 4 and 6 in the POP, stands for the 4% and 6% concentration of this component. The POP-4 is used for the analysis of STR typing and POP-6 for DNA sequencing. Recently a Pop-7 has been introduced that can be used for both the for essay writing International Business School STR typing and DNA sequencing [10]. The buffer is used to stabilize and solubilize the DNA. Writing Castle School. It also provide a charge for essay, the electrophoresis current.

Buffer concentration is an important aspect, because when it’s too high this can result in overheating of the capillary and custom, a loss of resolution. In order to avoid any problems with the running of the write Istituto electrophoresis, the buffer should be replaced regularly with a fresh sample [10]. The capillary is central for the separation during the electrophoresis. Services Castle. The capillary is made of glass or fused silica. The inner walls also have a hydroxyl groups that are negatively charged. A Good Essay. Positive ions from the buffer, creates a double layer.

The movement of ions creates an custom School electroosmotic flow, that can be reduced or eliminated when a coating is added to the inside layer of the thinking High School capillary (see figure 10). Custom Essay Services Trafalgar Castle School. Uncoated walls create problems for critical University, reproducible DNA separation. Suggested is to change the capillary after 100-150 runs or whenever a decline of essay writing services Trafalgar, resolution is noted [10]. Sanger method for DNA sequencing is a process where the thinking High use of polymerase incorporation is involved. The polymerase incorporation uses dideoxyribonucleatide triphosphates (ddNTPs) as chain terminators that is in turn followed by a separation step that is capable of single nucleotide resolution. Because there is no hydroxyl group at the end of the 3? ‘end of the nucleotide with a ddNTP the growing chain cannot continue growing. In the essay writing services Trafalgar Castle School mix there are both dNTPs and ddNTPS present, this way some DNA portions are still able to continue growing. Therefor at the end of the reaction there will be a series of strands that only differs one molecule from Tilton, each other.

See figure 11 for a schematic overview of the DNA sequence. Each DNA strand uses one forwards or reverse primer in a separate reaction. Attached to the ddNTPs are fluorescent dyes. ddTTP (thymine) has a red dye attached to it, ddCTP (cytosine) a blue label, ddATP (adenine) a green dye and lastly, ddGTP (guanine) a yellow dye. After the custom writing services Trafalgar School reaction is over, the sample goes through capillary electrophoresis, which separates the strands. In the results of the electrophoresis, the sequence of the DNA strand is shown [7]. DNA Databases and CODIS. A DNA database is a database which stores DNA data and is used for analysis. There are different types of help a essay Tilton, DNA databases.

The National DNA databases are maintained by the government for storing DNA profiles of custom essay writing services Castle School, its population. These DNA profiles are based on PCR and STR analysis. DNA databases serve as valuable tools in aiding investigations. Write Istituto London. CODIS (COmbined DNA Index System) is a DNA database that consists of custom writing Castle, 13 STR loci’s. These are CSF1PO, FGA, TH01, TPOX, VWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51 and D21S11. Also the critical thinking AUTO Amelogenin is used for gender determination [6] [10] [11]. To make the job easier and Castle, avoid confusion with buffers it is better to how to write essay The University, use a complete STR kit. These kits come with their own buffer and control DNA. There are a lot of distributors of complete STR kits. Custom Writing Services School. It all depends on the research what kind of kit there is needed. Multiplex STR kits allows the amplification of the 13 CODIS loci [6].

The most widely known and used kits are from Promega. London. The product components normally consists of a buffer, primer pair mix (again, it depends on the research what kind of custom essay writing Trafalgar Castle, primer that will be used), control DNA. These are for how to a successful essay The University of Canberra, the PCR product. After the PCR, the custom writing services School kits come with an Allelic Ladder mix and an internal standard to help writing Tilton, be used for the gel. Chemicals that sometimes should be supplied that do not come with the kit are Nuclease-free water and taq DNA polymerase. The kits come with their own protocol and should be used in custom essay writing Castle School that specific order [6]. Here is an example of the PowerPlex 16 HS System, which allows co-amplification of the 13 CODIS loci and Amelogenin for gender determination. All loci are amplified in a single tube and analyzed in a single injection and is also compatible with ABI. This system consist of Powerplex HS 5X Master Mix, Powerplex 16 HS 10X Primer Pair Mix, 2800M Control DNA and water (Amplification Grade) in the Pre-amplification components box. In the Post-amplification components box there is a PowerPlex 16 HS Allelic Ladder Mix and Internal Lane Standard.

How the mixes for the PCR amplification should be made is displayed below in help writing a essay Tilton figure 10 [6] [12]. Statistical interpretation of DNA profile. When it comes to getting a match with a DNA profile, it’s important to determine if the DNA profile are from the same individual or if maybe there is another individual with the same profile. It’s practically impossible to get a DNA from every individual. In order to still determine a match probability, Allele frequencies from different ethnic groups, from services Castle, validated databases are collected [13]. More than one data point will need to be collected in order to get a reliable estimation of allele frequency.

There has to be a minimum where the assurance is there that an allele has been sufficiently sampled for use in statistical test. An allele has to be observed for critical AUTO University, a minimum of five times in order to Trafalgar Castle School, be qualified for use in a statistical calculations. The frequency for the minimum allele is thinking AUTO University, determined using the formula 5/ (2N). N stands for the number of services Trafalgar, individuals and 2N for chromosomes counted before they pair [13]. In order to calculate the frequency of critical thinking text Justin-Siena, a DNA profile, the frequency of every allele analyzed are multiplied. The frequency of the writing Castle School allele can differ dependent on the population database.

The database that is used needs to be sufficiently large and representative of the population of the individual whose DNA is being examined [13]. In figure 12, DNA profile frequencies are given for Tilton, the U.S. Caucasian. Take for example allele 11 of D13S317 shown in figure 12. Custom Writing Services. Samples of 604 alleles were taken where it was observed 205 times. This translates to an allele frequency of 0,33940. In other words, there is a 34% chance that a random individual will have the same allele. The same goes for allele 14 of D13S317. Writing Hult Business School. This allele was observed 19 times in a population of 604. Frequency is therefore q=0,04801. Writing Trafalgar. So an individual with the alleles 11 and 14 for the D13S317, can be calculated using the formula 2pq (p standing for the first allele and q standing for thinking is SKODA University, the second allele).

Putting the custom frequency calculated in the formula creates 2 x 0,33940 x 0,0481= 0,0326. This frequency indicates that ??3% of the U.S. Caucasian population. The frequency of all the genotypes will then be multiplied to get the for essay International frequency of the DNA profile. In case of the DNA profile in figure 12, this comes to a combined frequency of 8,37 x 1014. Services Castle School. So 1 in 837 trillion [13]. In order to ensure that DNA testing is being performed correctly there are standards that the laboratories has to adhere to. These standards has to assurance the quality of the work.

Every laboratory should have a quality assurance program in place. Organization and management. First thing is to AUTO University, have a management staff that the authority and means to carry out the duty that is Castle, assigned to them and keep the quality assurance in the laboratory. Help Writing. There should also be a technical leader that is in charge of the essay Trafalgar technical operations. If the CODIS is in use at the laboratory, there should be a casework CODIS administrator who is accountable for CODIS on site.

The laboratory should also have two full time employees who are qualified DNA analysts. The responsibility, authority and interrelation of every personal operational at the laboratory has to write Istituto Marangoni, be specified and documented. Custom Castle. Lastly a contingency plan has to be in planned and approved in the case that a technical leader position is vacated [14]. The employees of the laboratory has to have the proper education and writing Ritz, experience. The job description of the personnel needs to writing services Trafalgar Castle School, have a written job description that can be expended with documentation of the responsibilities, duties and skills. The laboratory needs to be in write Istituto Marangoni possession of the training program for qualifying all analyst. Included are all the custom essay writing services DNA analytical procedures that will be performed by the personnel. Also all the practical exercises needs to include the examination of a range of samples that are routinely analyzed at the laboratory. The training program needs to teach and write Istituto Marangoni London, asses the skills and ability to perform a successful DNA analysis. The trainee needs to give an individual demonstration of capability, which shall be documented by essay Trafalgar Castle the laboratory. When a new analyst is hired the technical leader is tasked with accessing the writing persuasive essay Ritz Сolleges new hire`s previous training and be responsible for the proper documentation.

If modification of the essay writing services School training program is made, then this also has to a essay Tilton, be documented. All the analyst has to successfully complete the competencies test that covers the DNA techniques before working on actual casework. A documented program needs to be in essay writing services Castle place so that the technical qualifications are being kept. This can be done by thinking AUTO attending seminars, course, professional meetings or any other documented classes that are relevant. This all needs to add to a minimum of eight hours annually. Essay Writing Trafalgar. If training is given by the laboratory itself, all relevant information about the training and International School, the presenter needs to be documented. When training is done externally, certificates, program agenda or travel documentation can serve as the proper documentation of attendance. Multimedia and internet based programs needs to be approved by the technical leader.

Attendance needs to be formally documented and when the custom writing services Trafalgar School program is finished the technical leader reviews and approves it. Critical Text School. The laboratory also needs to have an approved program that is used for annual review of writing Castle, scientific literature. This way the analyst ongoing reading of scientific literature is documented. The laboratory needs to have access to help writing a essay Tilton, collections of information’s containing DNA analysis [14]. The technical leader also has certain qualification that needs to be tended to. The minimum education requirements are a Master`s degree in biology, chemistry or forensic science.

In addition they also need to have a successfully completed 12 semester or equivalent credit hours in the subject’s biochemistry, genetics, molecular biology and statistics or population genetics. In the custom essay services Trafalgar Castle 12 semester completed, there needs to be at least one graduate level course for the period of 3 semesters. The technical leader of also needs to have a minimum of three years of critical AUTO, experience in a forensic DNA laboratory, in which the laboratory participated in the identification and evaluation of biological evidence in writing services Trafalgar Castle School a criminal matter capacity. The duties of the technical leader includes overseeing the technical operation of the laboratory and being able to make decision of initiating, suspending od resuming DNA analytical operations. Other responsibilities include the evaluating and documenting of the themes writing International validation of methods used and proposing new or modified analytical procedures.

Also reviewing academic documents, training records and approve qualifications of essay School, new analyst before they are allowed to perform analysis on casework independently. The technical leader has to approve specifications for outsourcing agreements and review internal and external DNA audit that might needs to be corrected and documented. Help Writing A Essay School. Lastly the technical leader is custom essay writing Trafalgar School, responsible for annually reviewing and documenting of laboratory procedures and reviewing and approving of training, quality assurance and proficiency testing. The technical leader needs to be a full time employee and needs to write London, be accessible for consultation onsite, via the telephone or electronically [14]. As an employee of the Trafalgar laboratory, the analyst needs to have a minimum education of a good Cesar, a bachelor`s degree or advanced degree in biology, chemistry or forensic science related area, The analyst is expected to have completed the course work successfully with subject areas of biochemistry, genetics, molecular biology, statistics and population genetics. The analyst needs to have at least six months of experience in forensic human DNA laboratory experience. Essay Services Castle School. The experience of the analyst needs to be documented and if needed, experience augmented by additional training of DNA identification handlings of the laboratory. Before participating in casework, the analyst needs to complete analysis of a range of samples that the laboratory regularly encounters and complete a competency test [14]. Laboratories needs to be designed in a manner where the integrity of analyses and evidence is ensured. Entry to the laboratory needs to be controlled in order to themes for essay writing International Business School, prevent unauthorized personnel.

When keys or combinations are handed out, these needs to be documented and limited to custom essay writing, personnel that is designated by help writing School laboratory management [14]. Before PCR is custom services Castle, performed, the DNA extraction and persuasive essay Cesar, PCR set up, needs to be performed in either separate times or separate space. The amplified DNA, needs to be developed, processed and maintained on a room(s) that is separate from where the custom essay services Trafalgar evidence examination, DNA extraction or PCR setup areas are performed. Thinking Text Justin-Siena High. A robotic workstation can be used, only custom essay services Trafalgar Castle, if the writing a good persuasive analytical process has been validated. In that case DNA extraction, PCR setup and amplification can be performed in custom Trafalgar Castle School a single room. Writing A Essay School. Lastly procedures for the cleaning and essay writing Castle School, decontaminating of the write a successful essay The University facilities and its equipment needs be in place and followed [14]. In order to ensure the integrity of the physical evidence, the laboratory needs to have a documented evidence control system.

Evidence needs to custom Trafalgar Castle School, be marked with a unique tag on package of the evidence. A definition of the text Justin-Siena High evidence and work product needs to be clearly defined. When a tag is not used, a system for distinguish samples when they are being processed needs to be devised and put in place. Custom Essay Writing. Chain of custody needs to be documented and maintained, either on persuasive essay Cesar Сolleges a hard copy or in an electronic format. A signature or something equivalent in case of an electronic format needs to be present for all who received and transferred the evidence, with corresponding date. Documented procedures needs to be in essay Castle place in order to minimize loss, contamination and deleterious change of evidence.

A proper placement for evidence storage and work product that is still in progress needs to be in place, which is controlled and secure [14]. Analytical procedure that are to write The University, be had and followed, needs to be approved by essay writing services Castle School the technical leader. A Good Persuasive Сolleges. The procedures needs to be reviewed annually. Every analytical method needs to have their own standard operating procedure that needs to specify items like the reagents, sample preparation, extraction methods, equipment and controls. A written procedure for the documentation of commercial and formulated in-house reagents needs to be in place. Label commercial reagents with the name of the custom services Trafalgar reagent and expiration date. Formulated in-house reagents are to be labeled with the name of reagent, either the date of preparation or expiration date and the analyst who formulated the reagent. Critical reagents in test kit or systems for quantitative PCR and genetic typing needs to be identified and evaluated before they are used on evidence samples. Thermostable DNA polymerase, primer sets and write Marangoni London, allelic ladders, also needs to be identified and writing Trafalgar School, evaluated [14].

Before DNA amplification, evidence samples needs to be quantified. Only when a validated method system is used that have shown to give reproducibly and reliably yield a successful DNA amplification, quantification is not needed. When quantifying, quantification standards are to writing, be used. The positive and negative control needs to be amplified at the same time as the case samples at the same loci with the same set of primers as the case samples. Blank reagent controls that are being used for extraction, are to be extracted simultaneously, amplified by using the same primers, instrument and conditions as the case samples and typed by using the same instrument and injection conditions. The DNA procedures used by the laboratory are to custom essay writing Trafalgar Castle, be checked annually or when a major change is made in the method [14]. Procedure for the taking and maintaining casework notes needs to be in place. These needs need to support conclusion taken in the reports. The laboratory needs to maintain and retain, in hard or electronic form, all notes and documentation from analyst regarding their analysis. The casework reports needs to have the case identifier, a description of the critical thinking is SKODA evidence that was examined, description of the method used, the amplification system, results and/or conclusion, an interpretive statement, date that report is issued, the disposition of the evidence and lastly a signature and title [14]. Twice a year, with the first one occurring in the first six months and the second in the last 6 months f a year, a proficiency testing needs to be undergone by custom essay writing Trafalgar Castle School the analyst, technical reviewers, technicians and personnel appointed by the technical leader.

Workers who regularly use manual and automated methods, will need to School, go through a proficiency testing at least once a year. New workers needs to go through proficiency testing in the first six months. The proficiency testing needs to be defined, documented and custom essay Castle School, use the correct dates. The exact items from the proficiency testing that needs to be recorded are the test set identifier, the analyst/participant, date of analysis and its completion, copies of data and notes that supports the conclusions taken, the proficiency test results, discrepancies and if needed the corrective actions that were taken [14]. 1. Lessons Learned From 9/11: DNA Identification in Mass Fatality Incidents https://www.ncjrs.gov/pdffiles1/nij/214781.pdf. 2. Cesar. M.prinz, A. Carracacedo; DNA Commission of the International Society for Forensic Genetics (ISFG): Recommendations regarding the role of services Trafalgar, forensic genetics for disaster victim identification (DVI); Forensic Science International: Genetics; Pages 3-12; 2007. 3. How To Essay The University Of Canberra. B. Budowle, F.R. Bieber, A.J.

Eisenberg; Forensic aspects of mass disasters: Strategic considerations for DNA-based human identification; Legal Medicine; page 230-243;2005. 4. Mo Bi Tec molecular biotechnology. 5. NFSTC Science serving justice. 6. Forensic DNA typing STR: Page 62-64, 84-86,92,93. 7. Butler John M.; Advanced topic in forensic DNA typing: methodology; 2012; Elsevier, Maryland USA, page 371, 372, 141-150,417,418. 8. Sequencing, forensic analysis and genetic analysis http://www.atdbio.com/content/20/Sequencing-forensic-analysis-and-genetic-analysis#Short-tandem-repeats.

9. Sirius genomics. 10. Forensic science central; DNA. 11. FBI biometric analysis. 12. Promega technical manual for the powerplex 16 system. 13.

Butler John M.; Fundamentals of services Castle School, forensic DNA typing; 2010; Elsevier; Maryland USA; page 111-121, 229, 238-241, 251, 252. 14. Quality Assurance standards for forensic DNA testing laboratories. DNA analysis workload estimated worksheet. Search our thousands of essays:

If this essay isn't quite what you're looking for, why not order your own custom Science essay, dissertation or piece of coursework that answers your exact question? There are UK writers just like me on a good persuasive hand, waiting to help you. Each of us is qualified to a high level in our area of expertise, and we can write you a fully researched, fully referenced complete original answer to your essay question. Just complete our simple order form and you could have your customised Science work in essay Trafalgar School your email box, in as little as 3 hours. This Science essay was submitted to us by a student in order to help you with your studies. This page has approximately words. If you use part of this page in your own work, you need to provide a citation, as follows: Essay UK, Essay: Invesigating MH17 Forensic DNA analysis . Available from: http://www.essay.uk.com/essays/science/essay-invesigating-mh17-forensic-dna-analysis/ [04-10-17]. If you are the original author of this content and no longer wish to have it published on write essay Marangoni London our website then please click on the link below to request removal: 13-09-17 - The Human Genome project (HGP) 22-08-17 - Adeno associated virus (AAV) vectors 01-08-17 - Test methods on the alkali carbonate reaction in concrete - fluxonic diode - Identifying an unknown organism from essay Trafalgar, a cell phone 05-07-17 - Risk factors for alcohol abuse in men who have sex with men 01-06-17 - Monsanto vs. the world 19-05-17 - Patterns formed by increasing the scale factor – maths 12-05-17 - Swine influenza infections 24-04-17 - Medicinal plants and wound healing.

We offer professional custom essay writing, dissertation writing and coursework writing service. Our work is high quality, plagiarism-free and delivered on time. Essay UK is Justin-Siena, a trading name of Student Academic Services Limited , a company registered in England and custom services Trafalgar Castle, Wales under Company Number 08866484 .

How to buy essay cheap with no worries -
Custom Essay Writing Services - The Shocking Truth

50 Inspiring Resume Designs: And What You Can Learn From Them. Your resume or CV may be one of the most important projects you ever design. It can make or break job applications, open doors to new careers, make a great (or dismal) first impression. Writing Services Trafalgar School. When you send out your resume, you’re really sending out a piece of yourself. So make sure it’s representing you to your best advantage. Help Writing. Just like how you dress your best for an interview, it’s important to give your resume the same treatment — to make sure it’s polished and presentable. The 50 resume designs below span a wide range of School, styles, from strictly businesslike to ultra creative — browse through them to get some ideas for write updating your own resume. Writing School. Designing your own is easy with our wide collection of beautiful resume templates.

Click the image to see more resume templates. How To Write. Starting off your resume strong with a bold header, like in this design by Shed Labs for custom writing Trafalgar Castle Loft Resumes, draws attention to your name and makes it more memorable. You can also include a few keywords or descriptors under your name that sum up who you are as a candidate. This chessboard-style layout is certainly striking, giving each category its own distinct space. But Mikha Makhoul’s resume is still somewhat subdued thanks to the simple black-and-white color scheme; it doesn’t sacrifice professionalism for themes Hult Business School visual interest.

Some well-placed shadows can make your resume pop, literally — giving it a 3D appearance and creating the illusion of depth. Errol Veloso explains how he chose the colors of his design purposefully: blue to custom writing Trafalgar, symbolize his creative side and write a successful essay The University (Navitas), red to symbolize his analytic side. Try using shapes and frames for emphasis. You can experiment with geometric shapes (circles, squares, rectangles), ribbons, or solid or dashed lines. Essay Writing Services Trafalgar Castle. Here, Michael Long frames his name and his role to how to essay The University, help them stand out. Essay Services Castle School. A cohesive color scheme of cool blues and minty hues gives this information-packed, infographic-style resume by Joseph Acena a visual theme and an orderly, coordinated look. Using a horizontal orientation (instead of the traditional vertical format) immediately gives your resume an edge in terms of thinking, attracting attention. Other strong points of this design by Justin Schueler include a balanced, un-crowded layout and plenty of custom writing Trafalgar Castle School, negative space.

There seems to be a trend, at least in industries where you can take some risks with your resume, to forget the stuffy business lingo and show that there’s a human behind the piece of help a essay, paper. Using a more conversational tone, as David Elgena has done with his “Hello, nice to meet you. Here’s a little about me” header at the top of services Trafalgar Castle, this resume, may help you create rapport with the person who’s reviewing your application before you even meet them. This resume by Kyle Robertson features a custom crest with Kyle’s name and a catchy tagline. Creating a distinctive personal brand or style for yourself (such as a personal logo, a color scheme, a nice selection of fonts, etc.) gives your work an extra sheen of professionalism (and an essay of Canberra, opportunity to show off your abilities).

Plus, once you put the work in, this “brand” is something you can use over and over again — on custom School letterhead, business cards, social media profiles, you name it. For a unique take on traditional resume colors, try light text on a dark background, as Abdullah Al Mamun has done here. Just make sure that your font is weighty enough to be easily readable and not get lost against the background. This clean resume by Patrick Rogan uses a bright splash of color and themes for essay Business School, whittles down the information to Castle School, only the write essay of Canberra (Navitas) basics (skills and past positions). Icons in the skills section provide a visual reference that still complements the simplistic style. Printing your resume on textured paper can give an impression of quality, craftsmanship, or luxury. Custom Writing Trafalgar. If a color other than white seems inappropriate for your industry, try a white or cream-colored paper with a slight texture for an ultra-professional, upscale look. This example by S.N. How To Write A Successful The University (Navitas). Carter, printed on custom writing services School a recycled or kraft-style paper, gives the resume a custom, hand-printed feel. When applying for a position where a more creative approach isn’t appropriate, it’s always a safe bet to opt for essay a simple, text-based resume with clean fonts.

Here, Frank Schamhart has embellished his resume slightly with minimal use of an essay writing services Trafalgar Castle School, accent color and a small personal portrait. If you’re after a job in the arts or some other highly visual industry, make your resume a mini portfolio like illustrator Rianti Hidayat has done here. Thinking AUTO University. Bradley Brooks keeps his resume businesslike with a classic black-and-white color scheme, but livens things up with a modular layout and a personal logo. Infographic-style resumes have become popular, and they can be effective when done well. But they should be more than a collection of pretty pictures; the images should, at a glance, tell something about you and complement or enhance the text, like in this resume design by Rachel Winter. If you’re seeking work in an industry where appearance is custom essay writing services School important, or the job has asked you to themes Business, include a portrait, try integrating it into essay writing Trafalgar Castle your resume. Help A Essay Tilton. It doesn’t have to be the center of attention, though — you can make it a bit more subtle by custom services Trafalgar School using a small picture or placing it behind a colored screen, like in Egotype’s resume template. Mailing out some resumes? Make opening yours up a memorable experience, like Amber Van Mieghem has done with this clever folding resume. Wishing you could infuse a little creativity into your plain, corporate resume? Try a monogram with your initials, like Bill Mawhinney has done for this resume template.

It adds a little style while still keeping the critical thinking text High School overall presentation very businesslike. You can use the same graphic on your cover letter to give your application a polished, pulled-together look. If you have some creative leeway in creating your resume, using a non-rectangular shape will be sure to custom essay writing services Castle School, attract attention, like John Mujica’s round resume does here. Istituto Marangoni. If you do format your resume in any unusual shape, just make sure all the text is readable. You’ve only got one name. Essay Writing School. Make it memorable. For Essay Hult International Business. If it’s unique, highlight it.

Make it big and bold, like Fredrik Andresen did on his resume. Custom Essay Writing Trafalgar Castle School. Give the hiring manager something to zero in persuasive Cesar on. Your font choices can change the whole character of your resume. For instance, the rounded fonts with soft edges that Louis Omari has used for his resume have a more casual, friendly feel than sharper, serif fonts might have. Need to show your qualifications on the run? Post your resume online and custom services Trafalgar Castle, make it mobile-friendly, like Julien Renvoye has done. You can include your resume on writing essay Cesar Ritz Сolleges Switzerland your personal website or even post it to networking platforms like LinkedIn. Custom Essay Castle School. Use blocks of color and/or lines to separate different sections of a essay School, your resume, give it structure, and essay writing, make it easy to navigate visually. This template from Beautiful Resumes features vibrant colors, but you could just as easily get the same effect with a more subtle color scheme.

If you’re going the thinking High School infographic route, think of services Trafalgar Castle School, effective ways that you can use different types of critical thinking text Justin-Siena High School, graphs to services Trafalgar, represent your skills, experience, or background, like Martin Suster did here. Organizing your resume with columns, like this three-column layout Anton Yermolov used, keeps the information tidy, creates clear divisions between sections, and helps you keep everything sharply aligned. Use a sidebar in your resume to call attention to extra (or extra important) information that you want to a essay Tilton, highlight. Here, Ola Hamdy used a colored sidebar to custom writing services Castle, separate her personal and contact information from her educational and thinking AUTO, professional details. Although this resume design is text-heavy, Gershom Charig mixes things up with a two-color scheme and essay, a word cloud to creatively represent the breadth of his skills and experience. Similar in thinking Justin-Siena High School function to the word cloud above, various sizes of circles represent Silviu Schiau’s proficiency in custom writing services School various areas, such as management and design.

The size of the circles corresponds with his amount of experience — a fresh way to illustrate core competencies. Give the person looking at your resume an excuse to find out more about you. Including a link to your website or portfolio (or even a QR code, as Krysten Newby has done here) acts as a good prompt. If your job history includes working for for essay writing Hult International School big companies with recognizable logos, feature them on your resume. Tamas Leb has included space to do so on this resume template, and it makes an impressive statement, even at a glance. For creative resumes, a theme can give you a starting point to custom writing services Castle, build a one-of-a-kind design and think about innovative ways to present your information. Themes Hult Business School. Here, Peter Kisteman’s laboratory theme makes a strong visual statement and gives his artistic background a scientific, experimental dimension. Putting your resume in a folder or other kind of essay Trafalgar School, holder gives you more space to showcase your experience and accomplishments, plus the extra tactile feature makes it memorable, as with this design from S1M.

The vertical timeline on the outside offers an critical AUTO, immediate visual representation of the writing Trafalgar Castle candidate’s career history. This traditional black, white, and gray design by Brice Seraphin brightens up quite nicely with some turquoise as an accent. This can be done with any color (and you may want to tone it down depending on your industry), but vibrant hues have particular impact. Besides being another nice example of using an accent color, this design by writing a essay Adam Rozmus keeps things clean and simple, showing that resumes don’t have to be fancy to make a good impression. If competition is essay writing Trafalgar School stiff, try standing out with a resume package that gives you some space to London, demonstrate your abilities, develop a personal brand, and custom essay services Castle, include more information than the limited area of a one-page resume allows for. Here, Sabrae Precure uses a distinct color scheme and custom illustrations to stand out from the crowd. This resume by Gabriel Valdivia combines a traditional format (the typical positions, dates, and short descriptions) with pictorial elements that provide a more personal touch. As if to write essay Marangoni, say that a normal paper resume just won’t cut it, Alison Root got clever with her resume presentation, which demonstrates that she thinks outside the custom services Trafalgar box. This sample resume from Rahul Chakraborty features bold typography and bright colors for a high-impact look that will make people take notice. There may be times when it’s ok to let your sense of humor shine through in University your resume; it makes you more relatable, more likable. Writing Services Castle School. For instance, check out the pronunciation guide Nick Iannuccilli provided for his difficult last name.

Using a border is write essay The University (Navitas) a good way to add a little bit of color to your resume, as Evelien Callens has done here, without worrying about looking unprofessional. Stylistically, this design is essay writing School a good compromise between customary and more creative resumes. Themes For Essay Writing Hult. The two-color, mostly traditional layout uses graphic elements sparingly but purposefully. As a nice touch, Dan Hernandez has branded his cover letter with the same style, which is a smart idea if your job application involves submitting multiple documents. Sometimes you have to do what you can to get noticed. Custom Castle School. For an illustrator like Lucia Paul, hand-drawing her resume is both appropriate for her industry and gives her a standout way to display her skills. Big, bold typography, a high-contrast color scheme, and a well-organized presentation all combine to make sure Joao Andrade’s resume gets looked at. A Good Persuasive Essay Cesar Сolleges Switzerland. No long-winded explanations of Trafalgar Castle School, job roles here. Just the Tilton essentials — enough to get someone interested in writing School wanting to know more about Gianina Santiago and themes for essay writing Hult International School, her background. Clean, sans-serif fonts, relatively little text, and lots of white space give Maxat Malbekov’s resume a sleek look that’s easy to achieve if you condense your resume down to only the essay services Castle School most relevant information.

If you have a lot of information you need to fit on one page, take a tip from this design by Halle Rasco and use easy-to-read fonts and clear headings for each section. Writing Сolleges. Need to keep your resume fairly conservative? A two-column layout with a businesslike blue-gray accent color gives this otherwise traditional resume from ResumeBaker some extra interest. Essay School. Syril Bobadilla’s illustrations are whimsical and kid-friendly, and her resume reflects that style. Marangoni. Notice how she also created matching business cards for a cohesive personal brand. Even if your industry doesn’t allow as much creative expression as someone in the arts, you can express your personality in more subtle ways, like through font choices or an essay School, accent color. Resumes don’t always have to read from left to right, top to bottom. Writing Persuasive Cesar Ritz Switzerland. You can play with the layout of your resume to writing Trafalgar, make the best and most visually interesting use of the space you have available, like Milena Filipova has done here. You can use a grid structure to organize your resume and make it easier to navigate, similarly to how Orlando Silva designed this template. Write Essay Istituto Marangoni. If applicable, you might also try including some pieces from services, your portfolio right on write Istituto London the resume (so your abilities are on display at first glance). Custom Writing Services Trafalgar Castle School. As you can see from the how to essay The University of Canberra examples above, there are many approaches you can take to designing your resume.

But no matter what style or format you choose, there are a few things you want to make sure to get right: Readable text Industry-appropriate style (if unsure, play it safe with a conservative design.) Updated and accurate information No spelling/grammar errors. Now it#8217;s your turn. Put these skills into action! Bring great design to your entire workplace. Janie is a freelance writer and graphic designer and the owner of writing services Trafalgar School, Design Artistree Creative Studio.

After college, she built on thinking is SKODA AUTO her background in art to explore design. and loved it. Now, she enjoys finding ways to combine the craftsmanship of traditional fine arts with the writing services Trafalgar Castle digital possibilities of graphic design. Design The Perfect Google+ Banner Image With Tips And E. 50 Unique and Engaging About Us Pages to Inspire You. How To A Successful The University (Navitas). These Are Some of The Most Beautiful Album Covers We#8. Graphic Design From Around the World: Spanish Design. 60 Free Outline Icon Sets Perfect for Contemporary Desi. 60 Free Fonts for custom essay writing services Trafalgar Castle Minimalist Designs. 50 Free Headline Fonts Built For Impact And Audience En.

50 Beautiful Free Wallpapers For Creatives [2015 Editio. 50 Design Terms Explained Simply For Non-Designers. The 30 Best Free Social Media Icon Sets of 2015. Critical Thinking University. 100 Brilliant Color Combinations and How to custom essay services School, Apply Them . Free Icons: 49 Best Sites To Find Beautiful And Useful . 60 Awesome Free Tools To Create A Visual Marketing Camp. Free Stock Photos: 73 Best Sites To Find Awesome Free I. Write Istituto London. You're almost there!

You’ll receive an custom essay Trafalgar, email soon to confirm your subscription. Empowering the world to design. Get your dream job! Design a resume to impress using Canva#8217;s amazingly simple drag-and-drop design tool.

Order Your Own Writing Help Now -
Trafalgar Castle School - Whitby Private & Boarding …

Example Executive Resumes Other Career Marketing Documents. This client had achieved the pinnacle of custom Castle School success in a niche of the financial services industry and had grown somewhat bored and writing a good persuasive Switzerland ready for a new challenge. Writing Trafalgar School? With new corporate leadership in a good persuasive Сolleges Switzerland place, he felt the winds of change coming and wanted to custom essay writing services leave on for essay Hult Business School, his own terms and at the top of his game. Whether this was advisable or not was irrelevant by the time he came to me, as he had already resigned his position. His goal was to find a position that would challenge him, and custom essay writing Castle was particularly enthusiastic about the for essay International Business, prospect of building another niche player into a market leader. The bold red and blue color scheme matched this client’s bold personality. The charts and graphs helped emphasize his proven potential as a mastermind for custom services Castle, business growth. This client also had uncommon, value-add experience in the public sector and for essay writing International maintained a strong professional network of former colleagues and custom essay writing services Castle contacts in Washington D.C.

Considering that he worked within a highly regulated industry, he had leveraged this experience in his prior positions and we wanted to help writing Tilton School call attention to it in his resume even though it was from quite some time ago. We decided to essay writing services Trafalgar Castle include it but leave it undated. IT and Telecommunications Solutions Executive Resume. The client had three possible goals with this resume. For more than 12 years as an writing persuasive Ritz Switzerland expert in IT and custom essay writing services Castle School telecom solutions for hospitals and healthcare organizations, he had earned a comfortable living through his own independent consulting firm. However, he was concerned that the industry was changing and that he may need to adapt his approach in order to continue to prosper in his specialty. He felt there were three possible paths: 1) Use the resume in his efforts to build more business for his own consulting firm. 2) Seek out partnership opportunities with another small consulting firm that offered complementary services. 3) Be employed by a larger consulting firm and given charge of writing persuasive Ritz Сolleges Switzerland a practice area. It is difficult to handle three targets in a single resume, but as many of the writing services Trafalgar, same results and London benefits would appeal to all of these audiences, I believed there were enough similarities that we could create a single resume.

The first page provides an overview and summary of the client’s skills and qualifications, along with some of the big-picture benefits he produces for custom essay Trafalgar, clients. The rest of the write essay Istituto Marangoni, resume showcases some of the essay Trafalgar School, more recent and how to write a successful essay The University of Canberra significant projects he has worked on, in CAR format. The accomplishment boxes highlight the services Castle School, key quantifiable facts from each engagement. The client’s earlier experience was included to critical illustrate the breadth of writing his skills, which are applicable to industries other than healthcare, although the critical text High, client had chosen to pursue expertise in custom essay writing services Trafalgar Castle that narrow niche. Chief Medical Officer - Executive-level Medical Resume. This client was an extremely well educated, non-practicing MD and expert in global clinical RD within the pharmaceutical and biotech industries. He came to me with an extremely lengthy and detailed CV that he had been trying to critical is SKODA use in the corporate world, with little success.

It took some extensive consulting with the writing services Trafalgar, client to get him to think about his work in terms of results and benefits—especially results or benefits that we could quantify. He simply wasn’t used to thinking about his work in critical thinking AUTO University these terms and this was further complicated by the fact that it truly was difficult to quantify many of his accomplishments. Paring his extensive credentials and the technical details of his work down to just three pages was another challenge. The resulting resume was well worth it. The structure, formatting, and design of the entire resume was created to succinctly convey his many technical qualifications and make them as easy-to-read as possible at just a glance. Writing Services Trafalgar Castle? The highlights and big-picture impact of his contributions at critical text High School each company are set apart in an eye-catching box. Notable highlights for each are called out in a bulleted box. I created an addendum for details of his many additional credentials, and I instructed the client to essay writing services Trafalgar bring this with him as a leave-behind for interviews. Conservative design elements and coloring used in the resume help make it eye-appealing, but appropriate and acceptable to the target industry.

This client was challenged with how to write her resume because she was worried that her experience with multiple start-ups (many that were not successful due to no fault of her own) reflected poorly on her. She also struggled with how to communicate her many accomplishments despite the failed startups. Clearly we solved all her problems with this powerful and critical High School highly effective resume. She was also in a field in which a CV was sometimes requested, but not often. To prepare her for services Trafalgar, anything, we created this modular resume that included two addendums that she could include or not, as was appropriate. This accomplished client was ready for his next challenge and loved working in start-ups, early-stage growth companies, and Istituto turnarounds. This resume helped him accomplish his goals in essay writing Trafalgar Castle School record time. Within weeks of launching his search, he had accepted a job offer as the CTO of a growing company. Notice the technique used at the end.

We didn't want to date the resume further back than we did, but he had some early-career accomplishments that he wanted to for essay writing Hult International Business School convey. The other experience section allowed us to School do that without dating the resume too far back. What do you see that is unusual about this resume? We had reasons not to want to make the a good persuasive Cesar Switzerland, dates on this resume too obvious, and yet experience that dated back further than 20 years was still relevant. Rather than listing the essay writing services Trafalgar School, dates in themes for essay Business School a really obvious place, they are within the text of the resume. This may not work in some industries, but given the intended audience for custom essay services Castle, this resume, it was a highly effective technique. Entrepreneur Returning to the Corporate World in a Senior Sales Management Role - Sales Manager Resume. Tammy Lawson was on track for thinking is SKODA AUTO University, a very successful sales management career when she decided to leave the world of traditional employment to writing Trafalgar Castle School purchase and manage a franchise organization that was in distress and required turnaround. She was hugely successful in this endeavor and had built the company revenue more than $10 million over the past decade.

She had just sold the company a few months before when she came to me for a resume. While she had enjoyed the challenge of write essay Istituto London being her own boss, she yearned to go back to writing services Trafalgar her sales management career, which was her passion. However, she wasn’t sure how to present this in a resume, as her most recent experience made her appear overqualified and drew attention away from essay Istituto London her more relevant sales management experience. Her “ideal” job would include some aspect of sales training and custom mentoring as well, as this was something she loved doing and really excelled at, although none of her previous job titles reflected it. The solution was a resume that was very strategically written to focus on her most relevant sales qualifications and to deemphasize the fact that she had been the owner and top executive of the franchise company. While we were meticulously honest in our description of her most recent experience, we were quite selective about what we included and Marangoni London which aspects of her achievements we chose to focus on in order to emphasize the aspects most likely to be relevant in services School her next position.

A variety of graphics, charts, and graphs called attention to her most impressive accomplishments and areas of qualification. Help Writing School? Tammy’s training-related accomplishments are sprinkled throughout the resume. Dr. James Agard was a European-trained MD and U.S.-trained MBA with a long history of accomplishment as a practicing anesthesiologist. While he was still a practicing physician, his career had taken a turn into executive management and he wanted to continue this, hoping to writing Trafalgar Castle School land a CEO role. Themes Hult International School? He offered a very distinctive value proposition: the proven ability to transform medical operations into writing services Trafalgar School, a unified, seamless, high-quality, and cost-optimized “value-based” sustainable system founded on common purpose, vision, and teamwork. In the progressive leadership positions he had held over help a essay the most recent decade, he made great headway in this regard.

We used a variety of charts, graphs, and callouts to illustrate this very distinguishing value proposition throughout the resume. In particular, we illustrated Dr. Agard’s results in decreasing costs while simultaneously increasing quality of patient care, caseloads, and overall revenue. When Dr. Agard came to me, it was with a very detailed medical CV which included a very confusing chronology of his experience, since many of his positions have been simultaneous. Trafalgar Castle School? I rewrote his resume into a traditional executive format that showcased his stories of challenge-action-result-strategic impact success, particularly as they related back to his value proposition. Help Writing Tilton School? The emphasis throughout is on his leadership and management competencies, though his clinical highlights and custom essay Trafalgar medical credentials add essential credibility and a good Cesar Сolleges Switzerland are highlighted in his summary profile.

The color scheme of muted greens, browns, and golds create immediate eye appeal and are consistent with Dr. Agard’s conservative personality. Manufacturing Industry CEO Resume. Terrence came to me as a seasoned CEO, to have me prepare his first resume ever. He had a really incredible story for why his career had progressed as rapidly as it had (engineer to plant GM almost overnight).

As a young engineering professional, he was on a business trip and ended up talking with the man sitting next to him on the plane. That man was the owner of a company that was troubled and losing money. They had a lengthy discussion in essay writing Trafalgar Castle which Terrence offered a number of suggestions about how he would correct the problems and turn the business around. A couple of weeks later, the company owner called and recruited Terrence to help serve as GM of custom essay writing Trafalgar one of the most troubled plants. The hitch: he would receive NO salary until he turned it around. He quickly produced positive results and was later promoted to president of the entire company, and then recruited to the CEO role he was in themes writing International Business when he came to me. Custom Essay Writing School? This story was touched on in the resume by noting that he had been personally recruited by the owner, but I used it more extensively in the letters and biography that I also prepared for him. An excerpt from one of those letters: Do you want to be safe and good, or do you want to themes writing International Business take a chance and be great? I hadn’t heard this quote, attributed to essay writing Trafalgar School Jimmy Johnson, 20-plus years ago when I took my chance. Thinking High School? But it is a chance I will always be grateful I took, as it changed my life forever.

Driving profitable business growth, improvement, and essay Castle sustainable change. Those are the themes that have been present throughout my career, but my opportunities to really have an impact skyrocketed two decades ago, when by chance or fate I happened to strike up a conversation with the man sitting next to me on an airplane. At the Istituto London, time I was a young professional, not long out of college and beginning to establish myself in an engineering career. The man I was talking with turned to be the owner of a company, and after lengthy discussions regarding business philosophy he offered me a job with the essay writing School, challenge to turnaround a failing manufacturing plant. The catch? There would be zero pay until the plant was profitable. Write A Successful Essay Of Canberra (Navitas)? As risky as it might have seemed, I had faith in my potential, and essay writing services somewhere I found the critical AUTO University, courage to essay writing Trafalgar Castle School take the help writing School, chance… Terrence’s personal brand and value proposition was all about custom writing Trafalgar Castle School driving growth and results through the creation of a cohesive company culture of “We.” We showcased this in his profile section, and a good persuasive essay Switzerland I called out writing Trafalgar Castle, a quote from him that I had jotted in my notes during my consultation with him. The quote was perfect, because it emphasized his focus on producing results through teamwork, but also because it emphasized his philosophy of life and leadership which had been shaped by his early experiences. Again, we further drew this out in the other documents I prepared for him. Terrence had lots of help writing a essay Tilton School successes and results.

The Executive Performance Snapshots call immediate attention to the overriding story of success and his strategic impact in each position while complementing his brand. Rather than letting the reader get lost in a sea of bullets, I used a graphic element on each page to illustrate some of his quantified achievements in a format that was quick and essay writing easy to scan. The color scheme was selected to a good Ritz Сolleges give the custom essay writing Castle, resume an understated elegance while adding the visual appeal that would ensure his resume stood out. Insurance Reinsurance Industry Executive. Sales Engineering Executive Resume. Vice-President, Global Finance Manager Resume. Brianna was an interesting corporate finance executive. Writing? She didn’t have particularly strong mathematical or quantitative skills. Essay Services Trafalgar Castle School? Instead, for writing a good essay Cesar Ritz Switzerland, her it was all about understanding the underlying meaning of the numbers and how that meaning could be used to drive business strategy. As I interviewed her, her passion for this really shone through and she got really excited describing to me how the C-suite executives would come to custom writing Trafalgar Castle her and she would help them understand the numbers and University help them create strategy from them. Without a doubt, this was the key to writing services her personal brand and unique value proposition and we emphasized it throughout her resume.

The resume was slightly challenging in that Brianna had worked for essay Ritz Сolleges Switzerland, the same, well-known company for many years. This company had a strong public brand, but behind the scenes had really been struggling since the custom essay writing Castle School, economic crash about two years after Brianna had been hired. She had a really hard time communicating the specifics of her contributions to me and she said just the fact that the company was still alive indicated that. But now there were some serious efforts underway to sell the company, and as a whole it had never really bounced back from the downfall. After a lengthy conversation I was finally able to distill a number of specific achievements that balanced all of her contributions in a essay regards to cuts, streamlining, and RIFs with a few stories of growth from when she was first hired and from some specific parts of the business that did grow. Custom Essay Services Trafalgar? The result was a really strong resume that clearly positions Brianna as a high-level strategic and finance advisor to write essay Marangoni London the C-suite, but also as someone who is also able to produce results no matter what the situation: business growth or streamlining. The graphic used on the second page, with the plus and custom services minus sign, complements this theme. Information Technology Executive Resume - U.S. Writing A Good Ritz Сolleges? Expatriate. Carol was an interesting client in that just out of college, 18 years before, she picked up roots and writing services Trafalgar Castle School moved internationally, never looking back as her career took off.

Fast forward to the present and she was the mother of two school-aged children and really wanted to writing essay Ritz return to the U.S. We intentionally made her U.S. Services Trafalgar? citizenship and desire for a return to the U.S. very, very clear in writing a good persuasive essay Cesar Ritz the header of her resume. But, we were concerned that even understanding her citizenship, potential employers might view her complete break from the custom writing Castle, U.S. Themes Writing Hult Business? negatively, so I wrote the text of her resume to really emphasize how she was recruited and promoted aggressively over the years, as a way to explain why she had stayed in Ireland for custom essay services School, so long. This was also a major theme of the critical Justin-Siena High School, cover letters I wrote for her, as you can see from this excerpt: Some people swear that timing is everything. Custom Writing Services Castle School? Others insist that successful people make their own luck. As a 20-something who picked up roots and relocated internationally, I wasn’t really thinking about either at the time. Today, more than 18 years into an ever-progressing and always successful career, I am a true testament to both. Coming out of college with an M.B.A. and thinking AUTO a computer science degree from custom essay Trafalgar Castle School one of the most prestigious universities in the world, just as the dot.com era was being born in 1996, there could hardly have been a better place in the world for me to be than Europe. After all, as I’m sure you know, Ireland is well known as a world-class hub for high tech innovation and startups.

As a talented, ambitious, creative, and pioneering system and software architect, designer, and developer I was aggressively recruited to work on a number of innovative and a successful essay The University start-up technology initiatives and products. Recognized very early on for my leadership, I was sought out for team leadership roles in the first year of Trafalgar Castle School my career, a trend that has continued and accelerated since. Carol’s original resume was extremely detailed and technically focused. I rewrote it to emphasize her leadership and for essay writing Hult International Business management credentials and potential. Her major strengths included her unusually strong ability to clearly and deeply understand the issues at hand, cut through the clutter, and focus on the pivotal points most critical to success, creatively overcoming any obstacles on the path. Custom Essay Trafalgar School? These strengths drove her key value proposition: the persuasive Cesar Ritz Сolleges Switzerland, proven ability to steer world-class product development organizations to increased competitive advantage and stronger sales, profits, and custom writing School shareholder gains by leveraging innovation and maximizing quality and performance. This value proposition is clearly conveyed in her resume profile and also through the stories of success and achievements throughout her resume.

The graphical and text Justin-Siena High School design elements in custom essay writing services Trafalgar the resume gave her resume immediate visual appeal, but also provided us a way to convey the key results and contributions she had made. With a goal of essay The University of Canberra highlighting the content of her resume rather than drawing the eye away to custom writing Castle School design elements alone, we chose a muted color scheme that clearly let her impressive achievements shine through. Senior Sales Manager Resume - Industry Career Change. Jack Asher is an extraordinarily accomplished and write a successful essay of Canberra (Navitas) ambitious sales management executive with a BOLD and engaging personality—the type of person who has a presence that “fills” up a room when he walks into it. His leadership style was equally. bold and highly effective, as evidenced by the outstanding results he had produced consistently throughout his career. He had been in the insurance industry since the start of his career. Jack’s goal was to transfer his extraordinary sales management experience into a new industry.

Including the names of custom services his employers, which clearly indicated they were insurance. companies, was unavoidable, but we were careful to strip the resume of any other industry-specific language that would. pigeonhole him. Critical? The language used throughout the resume was carefully chosen to help show how Jack’s experience was transferable. The bold red and black color scheme and layout was selected to services Trafalgar Castle School complement his personal brand and value proposition which was all about bold leadership of top-producing sales organizations. The format allowed us to call out and draw attention to the. major achievement at each company, while further illustrating his value proposition with many results-indicative numbers. The testimonial on a good persuasive Ritz Сolleges, the second page was a perfect addition as the person had used language that clearly supported Jack’s brand. The. representative accomplishments section on the first page gave us a place to showcase Jack’s most impressive, career-wide accomplishments.

For almost her entire career this client had worked for the same hotel and resort company, which if presented incorrectly could make her career look stagnant. Custom Writing? As she was hoping this resume would help her make the transition to Cesar Ritz the CFO level, it was important to show that while her experience was all in one company, it was still progressive. The client was also concerned that her SVP job title wasn’t reflective of her potential and she really wanted to emphasize that she had worn many hats in a growing company, as well as the custom writing services, acting-CFO for a number of months. In order to really showcase the concepts of growth and progression, the Istituto Marangoni, resume content and custom writing services Trafalgar Castle School design was strategically developed to highlight the critical thinking, exponential growth of the company during the time this client was working for them, as well as her eight promotions through the years. The charts on the front page, with the eye-catching upward pointing arrows, really emphasize the business growth, while the writing Trafalgar Castle School, red-shaded accomplishment boxes in the body of the resume emphasize the client’s progression as well as the writing Tilton School, depth, diversity, and significance of essay writing Trafalgar her most prominent accomplishments. The client hoped to The University of Canberra remain in the hospitality/hotel industry or a related industry, so her relevant expertise in these was promoted in custom essay writing Trafalgar Castle School the text. Her passion and unique value proposition was all about building connections and teamwork to essay drive results, and this is really called out in the profile section with the included quotes. International Executive - CEO / COO Resume. This client was a multicultural, multilingual American expat who had spent his entire career working in the Middle East.

He was very accomplished and prided himself on creating ethical and transparent organizations that produced outstanding results and helped propel companies to the next level of success. He had progressed quickly in his career and was leading at the very highest level in his company, but without the essay Trafalgar, title to go along with it. He hoped to move his career to the next level, but was worried that his job title didn’t convey his level of experience. We quickly addressed this in help a essay Tilton School the job description, justifying his targeting of CEO roles. The rest of the resume is very results-focused and his contributions are highlighted using a variety of design, graphical, and charting techniques. Essay Trafalgar School? We chose a very conservative color scheme that the client thought would appeal to the audience he was targeting. We anticipated two primary audiences for the resume: 1) American companies doing business in the Middle East and writing persuasive Ritz Сolleges Switzerland 2) Middle Eastern companies doing business in the U.S. So as not to confuse the reader, we thought it was best to specify in the resume which currency we are referring to when we give monetary figures.

North American Controller Vice President - Finance Resume. Lucy was concerned that she had spent nearly a decade with a company that had been in rapid growth mode when she first joined them, but then quickly went into decline, beginning in 2008, along with the economy. She was worried that the company’s revenue decline would reflect back negatively on her capabilities. A second concern was that she had resigned from her last company with plans to start an writing services independent consulting firm. While she completed a few small assignments, she did not enjoy the sales and marketing aspect of running her own firm, and jumped at the chance to go back to traditional employment. Unfortunately, this left a not very flattering time period in her employment history. In consultation with the write essay The University (Navitas), client, it became clear that while her current employer’s revenues had declined (an aspect of the company she had zero control over), her contributions in reorganizing and streamlining the company so that it remained vital and positioned for future growth when the economy rebounded, were absolutely essential. Custom Essay Writing Services Trafalgar? Without her financial leadership, the essay Istituto London, company may have failed completely during these years.

Instead, by the time we were preparing this resume, the situation was looking much more optimistic for essay writing services Trafalgar Castle School, the company and they were entertaining several options to restart growth once again. The client’s very real contribution in all of write essay Marangoni this was her transformation of the essay services Trafalgar School, financial function from just an accounting arm of the company into thinking Justin-Siena High, a strategic business partner, a value proposition that we showcased throughout the resume. Care was also taken to balance the content with growth-focused language and achievements, to illustrate that Lucy’s value proposition was just as relevant and beneficial when a company was in growth mode. This helped to prevent her from being pigeon-holed as a leader for downsizing initiatives. Lucy was not able to provide any significant accomplishment stories from her consulting years. So, rather than take page space and attention away from the more relevant experiences, we chose to describe the Trafalgar School, consulting briefly at the end of the resume. To minimize the possible immediate impression of text Justin-Siena a gap in the resume, the employment dates were strategically placed next to job titles where they were not as visually obvious. When you invest in my Executive Resume Writing Career Marketing VIP services it is at NO RISK whatsoever, because if you follow through with the project and custom essay services Trafalgar School are not fully 100% satisfied with the themes for essay writing International Business School, quality of the services and deliverables that I provide, within one week of receiving the proof documents you can destroy the electronic copies of the proof files, return any other products or materials sent to you, and can request and receive a full 100% refund.

Executive Resumes - Traditional Grayscale Coloring. Chief Investment Officer / Senior Fund Manager - Investment Banking Resume. President / CEO / General Manager - Senior Manager Resume. Infographic Resume / Value Profile Examples. Networking Card - Front.

Networking Card - Back. Book your executive VIP project today. Or, if you still have questions, book an custom essay writing services Castle introductory 45-minute consultation with Michelle and get a $155 discount on Cesar Switzerland, the $100kCareerMarketing.com program. One-on-one, Michelle will go over your current resume and job search concerns, discuss the essay School, strategies she would use in writing your resume and is SKODA AUTO other portfolio documents, answer your questions, and give you the chance to custom essay writing services Trafalgar School benefit from her expertise and recommendations. There is no obligation and even if you choose not to proceed with the program, you win!

Toll Free: 1-800-644-9694. (You may need to leave a message. Please do! We promise to get back to you promptly and how to confidentially)